View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0696_high_7 (Length: 269)
Name: NF0696_high_7
Description: NF0696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0696_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 41338148 - 41337926
Alignment:
| Q |
1 |
ttattgagttgtatatgatctgttgcttgattaactttgaaacacaaaagctactcggaataagaggcatagaggaataaactcgatcaatgacaaattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41338148 |
ttattgagttgtatatgatctgttgcttgattaactttgaaacacaaaagctactcggaataagaggcatagaggaataaactcgatcaatgacaaattg |
41338049 |
T |
 |
| Q |
101 |
ccacaacaaaaaggtcgatcatacacatattttgaccagctactcttttac-nnnnnnnngaagtgtatgatagtataataataagggacttaaaaggat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41338048 |
ccacaacaaaaaggtcgatcatacacatattttgaccagctactcttttacttttcttttgaagtgtatgatagtataataataagggacttaaaaggat |
41337949 |
T |
 |
| Q |
200 |
tttatggctctgattgacaaagc |
222 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
41337948 |
tttatggctctgattgacaaagc |
41337926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University