View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0696_low_19 (Length: 314)
Name: NF0696_low_19
Description: NF0696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0696_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 101 - 222
Target Start/End: Original strand, 52366142 - 52366263
Alignment:
| Q |
101 |
ataaagtatcagggcaatgtattttctatacaactgtcnnnnnnnnnnnnntgcatttcctatacatgtagagatattattccaataacacgtcaaatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
52366142 |
ataaagtatcagggcaatgtattttctatacaactgtcaaaaaaataaaaatacatttcctatacatgtagagatattattccaataacatgtcaaatga |
52366241 |
T |
|
| Q |
201 |
taaatgataaacatattggcat |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
52366242 |
taaatgataaacatattggcat |
52366263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1191 times since January 2019
Visitors: 4407