View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0696_low_27 (Length: 298)
Name: NF0696_low_27
Description: NF0696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0696_low_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 98 - 210
Target Start/End: Original strand, 52542245 - 52542357
Alignment:
Q |
98 |
acaagtacacatatctatcaaacagnnnnnnngttatcattcgcagtttgcggaaaatagcagtatgttctaattccgcaacgctaaagcaactactcga |
197 |
Q |
|
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
T |
52542245 |
acaagtacacatatctatcaaacagaaacaaagttatcattcgcagtttgcggaaaatagcagtatgttctaattccgctacgctaaagtaactactcga |
52542344 |
T |
 |
Q |
198 |
cagcatattattc |
210 |
Q |
|
|
|||||| |||||| |
|
|
T |
52542345 |
cagcattttattc |
52542357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University