View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0696_low_27 (Length: 298)

Name: NF0696_low_27
Description: NF0696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0696_low_27
NF0696_low_27
[»] chr3 (1 HSPs)
chr3 (98-210)||(52542245-52542357)


Alignment Details
Target: chr3 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 98 - 210
Target Start/End: Original strand, 52542245 - 52542357
Alignment:
98 acaagtacacatatctatcaaacagnnnnnnngttatcattcgcagtttgcggaaaatagcagtatgttctaattccgcaacgctaaagcaactactcga 197  Q
    |||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||    
52542245 acaagtacacatatctatcaaacagaaacaaagttatcattcgcagtttgcggaaaatagcagtatgttctaattccgctacgctaaagtaactactcga 52542344  T
198 cagcatattattc 210  Q
    |||||| ||||||    
52542345 cagcattttattc 52542357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1226 times since January 2019
Visitors: 4412