View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0696_low_29 (Length: 278)
Name: NF0696_low_29
Description: NF0696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0696_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 36 - 230
Target Start/End: Complemental strand, 51416901 - 51416712
Alignment:
| Q |
36 |
ctagctgttgctacttgataaaatgcataacagtaaagtacagtacagtacgaatatccattgcaggtcaattatattggtcaaataatagcgtacccta |
135 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
51416901 |
ctagctgttgatacttgataaaatgcataacagta-----cagtacagtacgaatatccattgcaggtcaattatattggtcaaataataacgtacccta |
51416807 |
T |
 |
| Q |
136 |
caacaactacagatatctgatcttgaataatatgattcacctgcgacatgcacatgatgtgctatctcactcaatcagcattaacaatgatgatg |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51416806 |
caacaactacagatatctgatcttgaataatatgattcacctgctacatgcacatgatgtgctatctcactcaatcagcattaacaatgatgatg |
51416712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University