View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0696_low_31 (Length: 274)
Name: NF0696_low_31
Description: NF0696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0696_low_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 5e-71; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 58 - 239
Target Start/End: Original strand, 11815962 - 11816142
Alignment:
| Q |
58 |
aaaacactaatataca--agtacttttgtttgtatcttccaaaaatagggttttagattatacaatacaattcaatacaactcacattccatctcgatgg |
155 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11815962 |
aaaacactaatatacacaagtacttttgtttgtatcttccaaaaatagggttttagattatacaatacaat-----acaactcacattccatctcgatgg |
11816056 |
T |
|
| Q |
156 |
attaaatttctccgggttgagataatttgtaggatcc--atatgaatagctcttgaccaagttaacactttccatccttttagtat |
239 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11816057 |
attaaatttctccgggttgggataatttgtaggatccatatatgaatagctcttgaccaagttaacactttccatccttttggtat |
11816142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 129 - 233
Target Start/End: Original strand, 11826175 - 11826283
Alignment:
| Q |
129 |
aatacaactcacattccatctcgatggattaaatttctccgggttgagataatttgtaggatccatatga----atagctcttgaccaagttaacacttt |
224 |
Q |
| |
|
||||||||| ||||||||||| ||||| ||||||| |||| ||| |||||| |||||||||||| ||| ||||||||| |||||| ||||||||| |
|
|
| T |
11826175 |
aatacaacttacattccatcttgatgggttaaattcatccgagtttggataatatgtaggatccatgtgaatatatagctcttaaccaaggtaacacttt |
11826274 |
T |
|
| Q |
225 |
ccatccttt |
233 |
Q |
| |
|
||||||||| |
|
|
| T |
11826275 |
ccatccttt |
11826283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 129 - 230
Target Start/End: Original strand, 11800175 - 11800276
Alignment:
| Q |
129 |
aatacaactcacattccatctcgatggattaaatttctccgggttgagataatttgtaggatccatatgaatagctcttgaccaagttaacactttccat |
228 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||| || ||||| ||||| |||||| || |||||||||||||||||| |||| |||||||||| |
|
|
| T |
11800175 |
aatagaactcacatcccatctcgatggattaaattcatctgggtttgaataatatgtaggttcatgatgaatagctcttgaccatgttagcactttccat |
11800274 |
T |
|
| Q |
229 |
cc |
230 |
Q |
| |
|
|| |
|
|
| T |
11800275 |
cc |
11800276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1039 times since January 2019
Visitors: 4401