View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0696_low_35 (Length: 251)

Name: NF0696_low_35
Description: NF0696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0696_low_35
NF0696_low_35
[»] chr1 (1 HSPs)
chr1 (31-251)||(35289185-35289405)


Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 31 - 251
Target Start/End: Complemental strand, 35289405 - 35289185
Alignment:
31 aagtatgtgcttgcatgctcttcaacattgcatgtataaaccaaagcttgataattttcatcacaaaaggaaaacactttacacttcccttatcgccgat 130  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35289405 aagtatgtgcttgcatgctcttcaagattgcatgtataaaccaaagcttgataattttcatcacaaaaggaaaacactttacacttcccttatcgccgat 35289306  T
131 ctgattcactgctactcatacgatcaaaaggatgactgtttccttcatcatcggattccatggctaatcgcatgctctcttctgtccttctgctatggtt 230  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35289305 ctgattcactgctactcatacgatcaaaaggatgactgtttccttcatcatcggattccatggctaatcgcatgctctcttctgtccttctgctatggtt 35289206  T
231 aatgtccgagtgaacactccc 251  Q
    |||||||||||||||||||||    
35289205 aatgtccgagtgaacactccc 35289185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1848 times since January 2019
Visitors: 4432