View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0696_low_35 (Length: 251)
Name: NF0696_low_35
Description: NF0696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0696_low_35 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 31 - 251
Target Start/End: Complemental strand, 35289405 - 35289185
Alignment:
Q |
31 |
aagtatgtgcttgcatgctcttcaacattgcatgtataaaccaaagcttgataattttcatcacaaaaggaaaacactttacacttcccttatcgccgat |
130 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35289405 |
aagtatgtgcttgcatgctcttcaagattgcatgtataaaccaaagcttgataattttcatcacaaaaggaaaacactttacacttcccttatcgccgat |
35289306 |
T |
 |
Q |
131 |
ctgattcactgctactcatacgatcaaaaggatgactgtttccttcatcatcggattccatggctaatcgcatgctctcttctgtccttctgctatggtt |
230 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35289305 |
ctgattcactgctactcatacgatcaaaaggatgactgtttccttcatcatcggattccatggctaatcgcatgctctcttctgtccttctgctatggtt |
35289206 |
T |
 |
Q |
231 |
aatgtccgagtgaacactccc |
251 |
Q |
|
|
||||||||||||||||||||| |
|
|
T |
35289205 |
aatgtccgagtgaacactccc |
35289185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1848 times since January 2019
Visitors: 4432