View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0696_low_44 (Length: 214)
Name: NF0696_low_44
Description: NF0696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0696_low_44 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 4e-43; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 8 - 124
Target Start/End: Complemental strand, 43689887 - 43689771
Alignment:
| Q |
8 |
ttgcttctgtggagtggcttaatgtatatgaatggtaagttgctggaatnnnnnnnnctcccaattgtaggtcatatggatgattaaactatgctaaaga |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43689887 |
ttgcttctgtggagtggcttaatgtatatgaatggtaagttgctggaataaaaaaaattcccaattgtaggtcatatggatgattaaactatgctaaaga |
43689788 |
T |
|
| Q |
108 |
gggatcttgaatggaaa |
124 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
43689787 |
gggatcttgaatggaaa |
43689771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1619 times since January 2019
Visitors: 4425