View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0696_low_46 (Length: 206)

Name: NF0696_low_46
Description: NF0696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0696_low_46
NF0696_low_46
[»] chr1 (1 HSPs)
chr1 (21-169)||(49645789-49645937)


Alignment Details
Target: chr1 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 21 - 169
Target Start/End: Complemental strand, 49645937 - 49645789
Alignment:
21 aaattagtcatccgaagaaaaaatgtaggctgagaactcggatggagaacacacttgttaaannnnnnnggctgcttaacaataaagatttctttttaac 120  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||    
49645937 aaattagtcatccaaagaaaaaatgtaggctgagaactcggatggagaacacacttgttaaatttttttggctgcttaacaataaagatttctttttaac 49645838  T
121 taaaccaccattagtcatgtgattaacacaccccaacagctcttgtaaa 169  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||    
49645837 taaaccaccattagtcatgtgattaacacgccccaacagctcttgtaaa 49645789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University