View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0696_low_46 (Length: 206)
Name: NF0696_low_46
Description: NF0696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0696_low_46 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 21 - 169
Target Start/End: Complemental strand, 49645937 - 49645789
Alignment:
Q |
21 |
aaattagtcatccgaagaaaaaatgtaggctgagaactcggatggagaacacacttgttaaannnnnnnggctgcttaacaataaagatttctttttaac |
120 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
49645937 |
aaattagtcatccaaagaaaaaatgtaggctgagaactcggatggagaacacacttgttaaatttttttggctgcttaacaataaagatttctttttaac |
49645838 |
T |
 |
Q |
121 |
taaaccaccattagtcatgtgattaacacaccccaacagctcttgtaaa |
169 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
49645837 |
taaaccaccattagtcatgtgattaacacgccccaacagctcttgtaaa |
49645789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University