View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0697_high_11 (Length: 251)
Name: NF0697_high_11
Description: NF0697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0697_high_11 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 13 - 251
Target Start/End: Original strand, 51679150 - 51679394
Alignment:
| Q |
13 |
aatatattaactgctcccttcctctgcctctttactttacataccctgagaaaatgagcagaactagtaaaatgagtctcagctgtcacaagtatacaca |
112 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51679150 |
aatatattaactgctcccttcctctgcttctttactttacataccctgagaaaatgagcagaactagtaaaatgagtctcagctgtcacaagtatacaca |
51679249 |
T |
|
| Q |
113 |
aatattcat------atgcatcattctctttgcttcaacttccattttcatggctgaaggttagtctatttaccttgcttgcttctacaatccaatatga |
206 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51679250 |
aatattcataatcatatgcatcattctctttgcttcaacttccattttcatggctgaaggttagtctatttaccttgcttgcttctacaatccaatatga |
51679349 |
T |
|
| Q |
207 |
ttttatattcaatattccaacttgtaatattcttatttttaacca |
251 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51679350 |
tgttatattcaatattccaacttgtaatattcttatttttaacca |
51679394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1863 times since January 2019
Visitors: 4432