View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0697_high_5 (Length: 381)

Name: NF0697_high_5
Description: NF0697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0697_high_5
NF0697_high_5
[»] chr1 (2 HSPs)
chr1 (123-364)||(31226561-31226802)
chr1 (123-340)||(31173676-31173875)


Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 123 - 364
Target Start/End: Original strand, 31226561 - 31226802
Alignment:
123 ctcatttccttccccctctcttcacggaaaccttcttcgccggagacttaacagtcttagtcttaggcttgacgctcttcaccggagctttcttctttgc 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31226561 ctcatttccttccccctctcttcacggaaaccttcttcgccggagacttaacagtcttagtcttaggcttgacgctcttcaccggagctttcttctttgc 31226660  T
223 cgccgcaactttctttgctgctggctttacagctgcaattttcttccccggagaagtccttgttgttgtctttgcaacctttgcattaggtttcgctttt 322  Q
    |||||||||||||||||||||||||||| ||||||| | ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
31226661 cgccgcaactttctttgctgctggctttgcagctgcgactttcttccccggagaagtccttgctgttgtctttgcaacctttgcattaggtttcgctttt 31226760  T
323 gcagcagttttggccttagaagcagcttttgacttggtagca 364  Q
    ||||||||||||||||||||||||||||||||||||||||||    
31226761 gcagcagttttggccttagaagcagcttttgacttggtagca 31226802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 123 - 340
Target Start/End: Complemental strand, 31173875 - 31173676
Alignment:
123 ctcatttccttccccctctcttcacggaaaccttcttcgccggagacttaacagtcttagtcttaggcttgacgctcttcaccggagctttcttctttgc 222  Q
    |||||||||||||||||||||| |  | ||| ||||| ||||||||| |||||||||||||||||||||| ||| ||||||| |||| ||||||||||||    
31173875 ctcatttccttccccctctcttgatcgcaactttcttagccggagacctaacagtcttagtcttaggcttcacgttcttcactggagttttcttctttgc 31173776  T
223 cgccgcaactttctttgctgctggctttacagctgcaattttcttccccggagaagtccttgttgttgtctttgcaacctttgcattaggtttcgctttt 322  Q
                      |||||||||| ||| ||||| ||||||||| |||||||||||||| |||||||||||||||||||||||||| ||| ||||     
31173775 ------------------tgctggctttgcagttgcaactttcttccctggagaagtccttgtcgttgtctttgcaacctttgcattaggcttcactttc 31173694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University