View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0697_low_11 (Length: 464)
Name: NF0697_low_11
Description: NF0697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0697_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-100
Query Start/End: Original strand, 97 - 338
Target Start/End: Complemental strand, 7756764 - 7756523
Alignment:
| Q |
97 |
agaatgcaatagagaagcaatatcaaaagatgctgccaataaatccagtaagttttgacaatctctttataatttcttgcacatgcatttctaagagtag |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
7756764 |
agaatgcaatagagaagcaatatcaaaagatgctgccaataaatcaagtaagttttgacaatctctttataatttattgcacatgcttttctaagagtag |
7756665 |
T |
|
| Q |
197 |
gcaccacaattcgctttttctatataggacctagcaatgatcattgccaatgtcgtattctgcaggtaacatcttttgtttagctatcgcgggttttgtt |
296 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| | |||||||| || ||||||| |
|
|
| T |
7756664 |
gcaccacaatttgctttttctatataggagctagcaatgatcattgctgatgtcgtattctgcaggtaacatcttttttgcagctatcgtggattttgtt |
7756565 |
T |
|
| Q |
297 |
aaattatgagttagtacagggttctctgcataaatcagaact |
338 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
7756564 |
aaattatgacttagtacagggttctatgcataaatcagaact |
7756523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1438 times since January 2019
Visitors: 4416