View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0697_low_23 (Length: 284)
Name: NF0697_low_23
Description: NF0697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0697_low_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 38 - 271
Target Start/End: Original strand, 33789214 - 33789447
Alignment:
Q |
38 |
taataaactttgtctttnnnnnnnntaaacatcagagttgagactaattgaataacttaccttagtttcataaccttcaggaagttgcctgatgaaatta |
137 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
33789214 |
taataaactttgtcttttaaaaaaataaacatcagagttgagactaattaaataacttaccttagtttcataaccttcaggaagttgcctaatgaaatta |
33789313 |
T |
 |
Q |
138 |
tgtgcattagcagcagaagaagcagcaacaatttcatccatagtagcatcatttttcccaaacataatattttccttaatagatgtcccaaacatagcat |
237 |
Q |
|
|
|| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
33789314 |
tgagcattggcagcagaagaagcagcaacaatttcatccatagtagcatcatttttcccaaacataatattttccttaatagatgttccaaacatagcat |
33789413 |
T |
 |
Q |
238 |
gttcttgactcacaagtcccattttccctctaat |
271 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
33789414 |
gttcttgactcacaagtcccattttccctctaat |
33789447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University