View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0697_low_31 (Length: 245)
Name: NF0697_low_31
Description: NF0697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0697_low_31 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 18 - 245
Target Start/End: Complemental strand, 29908983 - 29908756
Alignment:
| Q |
18 |
cagtttttatatgttatctgatgttgctcctggaaaggagtcttggagattcattgttcgtgtggtgcatctgtgggaggttcctgcgtttcttcatcct |
117 |
Q |
| |
|
||||||| || |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
29908983 |
cagttttgatctgttatctgatgctgctcctggaaaggagtcttggagattcattgttcgtgtggtgcgtctgtgggaggctcctgcgtttcttcatcct |
29908884 |
T |
 |
| Q |
118 |
gaacaggtgaattcggttgagatggtgttggttgatgagaaggttggtgtttttatttaaacttccctggttttagcttttgattttgtcatttgtcctt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29908883 |
gaacaggtgaattcggttgagatggtgttggttgatgagaaggttggtgtttttatttaaactgccctggttttagcttttgtttttgtcatttgtcctt |
29908784 |
T |
 |
| Q |
218 |
ttgctcaaggttgtatgtcatgttgatt |
245 |
Q |
| |
|
||| |||||||||||||||||||||||| |
|
|
| T |
29908783 |
ttgttcaaggttgtatgtcatgttgatt |
29908756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 34 - 162
Target Start/End: Complemental strand, 29908151 - 29908023
Alignment:
| Q |
34 |
tctgatgttgctcctggaaaggagtcttggagattcattgttcgtgtggtgcatctgtgggaggttcctgcgtttcttcatcctgaacaggtgaattcgg |
133 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||| || | | |||||||||| | || |||||||| | ||||| | ||||| |
|
|
| T |
29908151 |
tctgatgttcttcctggaagagagtcttggagattcaagcttcgtgttgttcgtttgtgggaggtgcgtgattttcttcaatcataacagatcaattcaa |
29908052 |
T |
 |
| Q |
134 |
ttgagatggtgttggttgatgagaaggtt |
162 |
Q |
| |
|
||||||||||||| ||||||||||||||| |
|
|
| T |
29908051 |
ttgagatggtgtttgttgatgagaaggtt |
29908023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University