View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0697_low_33 (Length: 241)
Name: NF0697_low_33
Description: NF0697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0697_low_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 9e-88; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 58 - 229
Target Start/End: Complemental strand, 37444077 - 37443906
Alignment:
| Q |
58 |
tatcaatatgtgtgtatttgaacactaaaaagcgcttatctcatttagtaagctcttccatattccctcgcgtagacggtgcttcatagtattccactag |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37444077 |
tatcaatatgtgtgtatttgaacactaaaaagcgcttatctcatttagtaagctcttccatatgccctcgcgtagacggtgcttcatagtattccactag |
37443978 |
T |
|
| Q |
158 |
ttacaatgtttttattctccttacccctccctttctatatctgcttcatcctttcaatgaagtatccctctg |
229 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37443977 |
ttacaatgtttttattttccttacccctccctttctatatctgcttcatcctttcaatgaagtatccctctg |
37443906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 37444116 - 37444077
Alignment:
| Q |
1 |
ttttgaaccaaaattataagctatttttggagagcttact |
40 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
37444116 |
ttttgaaccaaaattataagctatttttggaaagcttact |
37444077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 257 times since January 2019
Visitors: 4374