View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0697_low_35 (Length: 228)
Name: NF0697_low_35
Description: NF0697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0697_low_35 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 7 - 228
Target Start/End: Original strand, 29755072 - 29755293
Alignment:
Q |
7 |
tttaaactacctgattaaactagccaattggaccggaaatcggccatttgatataatggttgaaagacaatggctagcacatgaataatgtcaaaacata |
106 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29755072 |
tttaaactacctgattaaactagccaattggaccgggaatcggccatttgatataatggttgaaagacaatggctagcacatgaataatgtcaaaacata |
29755171 |
T |
 |
Q |
107 |
ttttaatttgatcaatgttgtgtaataaatctcacttaagattctttatacatcaatgagctttgttctaaaataaacgtcgtttaagatttttcaaaca |
206 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29755172 |
ttttaatttgatcaatgttgtgtaataaatctcacttaagattctttatacatcaatgagctttgttctaaaataaacgtcgtttaagatttttcaaaca |
29755271 |
T |
 |
Q |
207 |
aataaaaaacatgctaacaaaa |
228 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
29755272 |
aataaaaaacatgctaacaaaa |
29755293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University