View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0698_low_1 (Length: 459)
Name: NF0698_low_1
Description: NF0698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0698_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 84 - 358
Target Start/End: Original strand, 34327031 - 34327305
Alignment:
| Q |
84 |
tgaattagttaaatgatttcttggagcaataacaggttgtcccatgttgatgtcaacaagttcaggcctgcatgcttcatcaccatgatttccctctcaa |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34327031 |
tgaattagttaaatgatttcttggagcaataacaggttgtcccatgttgatgtcaacaagttcaggcctgcatgcttcatcaccatgatttccctctcaa |
34327130 |
T |
|
| Q |
184 |
aggcatacaccctttcggtatcgtgtttttgggcaatgggaccttaccttacaaacaatgacatatttgtagggaatgtcctatgtatatatctttccaa |
283 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34327131 |
agccatacaccctttcggtatcgtgtttttgggcaatgggaccttaccttacaaacaatgacatatttgtagggaatgtcctatgtatatatctttccaa |
34327230 |
T |
|
| Q |
284 |
tgtcatgttacttaacaaataattcatcatcatagaactttctctctcttttattttattaaattcagaacttgg |
358 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34327231 |
tgtcatgttacttaacaaataattcatcatcatagaactttctctctcttttattttattaaattcagaacttgg |
34327305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1283 times since January 2019
Visitors: 4365