View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0698_low_10 (Length: 288)
Name: NF0698_low_10
Description: NF0698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0698_low_10 |
 |  |
|
[»] scaffold0257 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 16 - 256
Target Start/End: Original strand, 5653196 - 5653427
Alignment:
Q |
16 |
atacttgaatttgatatttggaatcgtacattaatgaggcagtccaactctgaaaaaattagatgtgtctgatcaaggattgannnnnnnnnnnnnnnnn |
115 |
Q |
|
|
|||| ||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5653196 |
atacatgactttgatatttggagtcgtacattaatgaggcagtccaactctgaaaaaattagatgtgtctgatcaaggattgattttttttttttt---- |
5653291 |
T |
 |
Q |
116 |
nnnnngacaaagtgtgatcaaagattaatctacttttctttgtttattttttgttgtcacattagttgtttcatgaatggttgttcaaataacataaaat |
215 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
T |
5653292 |
-----gacaaagtgtgatcaaagattaatctacttttctttatttatttttggttgtcacattagttgtctcattaatggttgttcaaataacataaaac |
5653386 |
T |
 |
Q |
216 |
taatcttatagcggattcaaagatcttaaagacataagaat |
256 |
Q |
|
|
|||||||||||||||||||||||| || ||||||||||||| |
|
|
T |
5653387 |
taatcttatagcggattcaaagatatttaagacataagaat |
5653427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0257 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0257
Description:
Target: scaffold0257; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 143 - 210
Target Start/End: Original strand, 24083 - 24150
Alignment:
Q |
143 |
atctacttttctttgtttattttttgttgtcacattagttgtttcatgaatggttgttcaaataacat |
210 |
Q |
|
|
|||||||||||||||||||| ||| |||||| | |||||| || ||| |||| || |||||||||||| |
|
|
T |
24083 |
atctacttttctttgtttatctttggttgtcccgttagttattccataaatgatttttcaaataacat |
24150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University