View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0698_low_3 (Length: 381)
Name: NF0698_low_3
Description: NF0698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0698_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 105 - 372
Target Start/End: Original strand, 9546349 - 9546619
Alignment:
Q |
105 |
gttgttgttcatactgatcatcttgatgttgttgatcatgacgttgtgtatgagttttccatatgttgttatcttcgcgagacaatgatatgagnnnnnn |
204 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9546349 |
gttgttgttcatactgatcatcttgatgctgttgatcatgacgttgtgtatgagttttccatatgttgttatcttcgcgagacaatgatatgagaaaaaa |
9546448 |
T |
 |
Q |
205 |
ngctacttcttcttcagttgttatatccgatgaagaactcagtacagaaacagactcattctgtactgagtttttcaccggatc---atctttcttgacc |
301 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
9546449 |
agctacttcttcttcagttgttatatccgatgaagaactcagtacagaaaaagactcgttctgtactgagtttttcaccggatcattatctttcttgacc |
9546548 |
T |
 |
Q |
302 |
cgtttggatcgtggaccagttggattctttgatgattcagtttcactttctctatcttcctgaagaattat |
372 |
Q |
|
|
|||||||||||||| ||||||||||||||||| || |||||||||||| |||||||||||||||||||||| |
|
|
T |
9546549 |
cgtttggatcgtggtccagttggattctttgacgactcagtttcacttcctctatcttcctgaagaattat |
9546619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University