View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0698_low_6 (Length: 314)
Name: NF0698_low_6
Description: NF0698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0698_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 10 - 257
Target Start/End: Complemental strand, 21140750 - 21140503
Alignment:
Q |
10 |
gcagagaatcattatcacaaggcaaaggcaaacccaccaacagaacctaaaataaataaagagaccaacaaagataatggtcacaacattgctgcacaaa |
109 |
Q |
|
|
|||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
T |
21140750 |
gcagagaaccattatcaaaaggcaaaggcaaacccaccaacagaacctaaaataaataaagagaccaacaaagaaaatggtcacaacattgctgctcaaa |
21140651 |
T |
 |
Q |
110 |
cgttcaccttcagggaattggctgcaatcacaagaaactttaggcaggaaaatctaataggtgaaggtggatttggtagagtttataaaggaagacttga |
209 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
21140650 |
cgttcaccttcagggaattggctgcaatcacaagaaactttaggcaggaaaatctaataggtgaaggtggatttggtagagtttataaaggaagacttga |
21140551 |
T |
 |
Q |
210 |
aaaaaccaaccaggtaagaatatgccactttttcattcattgttatgt |
257 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
21140550 |
aaaaaccaaccaggtaagaatatgccactttttcattcattattatgt |
21140503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University