View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0699_high_8 (Length: 251)
Name: NF0699_high_8
Description: NF0699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0699_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 118 - 236
Target Start/End: Complemental strand, 29908665 - 29908547
Alignment:
Q |
118 |
ccttaatcttaccagtgttaatgagattgttcagcagaccgttgatattcatctgctggtggtttgacttttgtaacatatttggtgaaattttcgcggt |
217 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29908665 |
ccttaatcttaccaatgttaatgagattgttcagcagaccattgatattcatctgctggtggtttgacttttgtaacatatttggtgaaattttcgcggt |
29908566 |
T |
 |
Q |
218 |
ttaatgagcctttttgaat |
236 |
Q |
|
|
||||||||||||||||||| |
|
|
T |
29908565 |
ttaatgagcctttttgaat |
29908547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1188 times since January 2019
Visitors: 4365