View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0699_low_12 (Length: 258)

Name: NF0699_low_12
Description: NF0699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0699_low_12
NF0699_low_12
[»] chr3 (2 HSPs)
chr3 (97-143)||(2772277-2772323)
chr3 (48-82)||(2772246-2772280)


Alignment Details
Target: chr3 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 97 - 143
Target Start/End: Original strand, 2772277 - 2772323
Alignment:
97 taacgcagcttattggatgagctgacattgcaggttctaaactgatt 143  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
2772277 taacgcagcttattggatgagctgacattgcaggttctaaactgatt 2772323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 48 - 82
Target Start/End: Original strand, 2772246 - 2772280
Alignment:
48 gaaagttttcctacttccactggaagcttcctaac 82  Q
    |||||||||||||||||||||||||||||||||||    
2772246 gaaagttttcctacttccactggaagcttcctaac 2772280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1396 times since January 2019
Visitors: 4413