View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0699_low_12 (Length: 258)
Name: NF0699_low_12
Description: NF0699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0699_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 97 - 143
Target Start/End: Original strand, 2772277 - 2772323
Alignment:
| Q |
97 |
taacgcagcttattggatgagctgacattgcaggttctaaactgatt |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2772277 |
taacgcagcttattggatgagctgacattgcaggttctaaactgatt |
2772323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 48 - 82
Target Start/End: Original strand, 2772246 - 2772280
Alignment:
| Q |
48 |
gaaagttttcctacttccactggaagcttcctaac |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
2772246 |
gaaagttttcctacttccactggaagcttcctaac |
2772280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University