View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0699_low_14 (Length: 251)

Name: NF0699_low_14
Description: NF0699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0699_low_14
NF0699_low_14
[»] chr5 (1 HSPs)
chr5 (118-236)||(29908547-29908665)


Alignment Details
Target: chr5 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 118 - 236
Target Start/End: Complemental strand, 29908665 - 29908547
Alignment:
118 ccttaatcttaccagtgttaatgagattgttcagcagaccgttgatattcatctgctggtggtttgacttttgtaacatatttggtgaaattttcgcggt 217  Q
    |||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29908665 ccttaatcttaccaatgttaatgagattgttcagcagaccattgatattcatctgctggtggtttgacttttgtaacatatttggtgaaattttcgcggt 29908566  T
218 ttaatgagcctttttgaat 236  Q
    |||||||||||||||||||    
29908565 ttaatgagcctttttgaat 29908547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1422 times since January 2019
Visitors: 4416