View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0699_low_18 (Length: 243)
Name: NF0699_low_18
Description: NF0699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0699_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 29 - 156
Target Start/End: Complemental strand, 36813462 - 36813335
Alignment:
Q |
29 |
ataacttcaattatgcatgcactagctttaagattccaagtgatttcgataatatatggccctagctttaagattaggaaaagaaaggcaccttactata |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36813462 |
ataacttcaattatgcatgcactagctttaagattccaagtgatttcgataatatatggccctagctttaagattaggaaaagaaaggcaccttactata |
36813363 |
T |
 |
Q |
129 |
ttcacatgtttcaaaaacattagtctct |
156 |
Q |
|
|
|||||||||||||||||||||||||||| |
|
|
T |
36813362 |
ttcacatgtttcaaaaacattagtctct |
36813335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1704 times since January 2019
Visitors: 4429