View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0699_low_5 (Length: 394)
Name: NF0699_low_5
Description: NF0699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0699_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 80 - 365
Target Start/End: Original strand, 48851154 - 48851439
Alignment:
| Q |
80 |
gagcagagaaaccataatgagcattgactttaagcatccattcaacagcttcacgacgaggttgagagagtgagtcaaagttcatcacatttttcagatc |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
48851154 |
gagcagagaaaccataatgagcattgactttaagcatccattcaacagcttcacgacgaggttgagtgagtgagtcaaagttcatcacatttttcagatc |
48851253 |
T |
|
| Q |
180 |
gtcataataagtttcttgttgaatcttttctttggagaaaagagtgttgagttcttcatcttcattgaacaagttctgttctaataaaagcagaggtaaa |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48851254 |
gtcataataagtttcttgttgaatcttttctttggagaaaagagtgttgagttcttcatctttattgaacaagttctgttctaataaaagcagaggtaaa |
48851353 |
T |
|
| Q |
280 |
agggaagtagagtccaatatatcattgtttgttgttgtgacatcactttgttctccttcttcatcaacaacttctccttcatcatc |
365 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48851354 |
agggaagtagagtccaatatatcattgtttgttgttgtgacataactttgttctccttcttcatcaacaacttctccttcatcatc |
48851439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 127 times since January 2019
Visitors: 4370