View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0699_low_6 (Length: 345)
Name: NF0699_low_6
Description: NF0699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0699_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 29 - 338
Target Start/End: Complemental strand, 36813462 - 36813153
Alignment:
| Q |
29 |
ataacttcaattatgcatgcactagctttaagattccaagtgatttcgataatatatggccctagctttaagattaggaaaagaaaggcaccttactata |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36813462 |
ataacttcaattatgcatgcactagctttaagattccaagtgatttcgataatatatggccctagctttaagattaggaaaagaaaggcaccttactata |
36813363 |
T |
 |
| Q |
129 |
ttcacatgtttcaaaaacattagtctctctgttgcacactgatcgtttagacttttaaatggcaaaatgtcaattcatgaacaagctagctcttagtctt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36813362 |
ttcacatgtttcaaaaacattagtctctttgttgcacactgatcgtttagacttttaaatggcaaaatgtcaattcatgaacaagctagctcttagtctt |
36813263 |
T |
 |
| Q |
229 |
taaagcattttcaaaaataacccgagaaacctgtcgttgaatatttttccacgactccatgtcatcgatcattgtcgttcaatcagatctagctaacagt |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36813262 |
taaagcattttcaaaaataacccgagaaacctgtcgttgaatatttttccacgactccatgtcatcgatcattgtcgttcaatcagatctagctaacagt |
36813163 |
T |
 |
| Q |
329 |
attcatctca |
338 |
Q |
| |
|
|||||||||| |
|
|
| T |
36813162 |
attcatctca |
36813153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University