View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0700_low_11 (Length: 305)
Name: NF0700_low_11
Description: NF0700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0700_low_11 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 80 - 305
Target Start/End: Original strand, 5217542 - 5217767
Alignment:
| Q |
80 |
tcatcattttcaagtcatacatttcctcagatggtggatggtttatggacggtcagtgtttatccttcttagagtggaattcctttaacattgtttacct |
179 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5217542 |
tcatcatttccaagtcatacatttcctcagatggtggatggtttatggacggtcagtgtttatccttcttagagtggaattcctttaacattgtttacct |
5217641 |
T |
 |
| Q |
180 |
gtatttttccataaaccatgataatgataattgagcaatttatcattnnnnnnnngcttacttttatcttgttttttgacctattattattactaccaca |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
5217642 |
gtatttttccataaaccatgataatgataattgagcaatttatcatttaaaaaaagcttacttttatcttgtttttggacctattattatgactaccaca |
5217741 |
T |
 |
| Q |
280 |
ttatcatatgatatcagcaaaatttt |
305 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
5217742 |
ttatcatatgatatcagcaaaatttt |
5217767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University