View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0700_low_14 (Length: 230)
Name: NF0700_low_14
Description: NF0700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0700_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 42 - 84
Target Start/End: Complemental strand, 8971955 - 8971913
Alignment:
| Q |
42 |
actccaactcaagaaacatcatttatcttcaattcatctcact |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8971955 |
actccaactcaagaaacatcatttatcttcaattgatctcact |
8971913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 42 - 84
Target Start/End: Original strand, 9027846 - 9027888
Alignment:
| Q |
42 |
actccaactcaagaaacatcatttatcttcaattcatctcact |
84 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
9027846 |
actccatctcaagaaacatcatttgtcttcaattgatctcact |
9027888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 60 times since January 2019
Visitors: 4369