View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0700_low_7 (Length: 391)
Name: NF0700_low_7
Description: NF0700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0700_low_7 |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 376; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 376; E-Value: 0
Query Start/End: Original strand, 16 - 391
Target Start/End: Original strand, 125356 - 125731
Alignment:
Q |
16 |
agccaaagaagcagggcattccataattatttatcccaacccataaccccagcggcatgtcaaatgcagtgagacgatgtgttgtatcaaacaccacagc |
115 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
125356 |
agccaaagaagcagggcattccataattatttatcccaacccataaccccagcggcatgtcaaatgcagtgagacgatgtgttgtatcaaacaccacagc |
125455 |
T |
 |
Q |
116 |
atcaccgaagatatcatacaattggatggatgaggcataggaccaggcaatattttctaaacggttgtttgcatcaagtgtgtactcaaatttaaaatta |
215 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
125456 |
atcaccgaagatatcatacaattggatggatgaggcataggaccaggcaatattttctaaacggttgtttgcatcaagtgtgtactcaaatttaaaatta |
125555 |
T |
 |
Q |
216 |
ggatctttgtccttaatatttctgcacattcttaacaaatctagggtttcttcttctggatctaattttctaaatgactggagtaaattccttacgtcct |
315 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
125556 |
ggatctttgtccttaatatttctgcacattcttaacaaatctagggtttcttcttctggatctaattttctaaatgactggagtaaattccttacgtcct |
125655 |
T |
 |
Q |
316 |
tttcagtaaaaggcaaatatccaggttcgacgcacttctcaagctccataagtctcatcatttgatgaacagaaat |
391 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
125656 |
tttcagtaaaaggcaaatatccaggttcgacgcacttctcaagctccataagtctcatcatttgatgaacagaaat |
125731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University