View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0701_high_4 (Length: 322)

Name: NF0701_high_4
Description: NF0701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0701_high_4
NF0701_high_4
[»] chr8 (1 HSPs)
chr8 (228-318)||(11404222-11404312)


Alignment Details
Target: chr8 (Bit Score: 71; Significance: 4e-32; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 228 - 318
Target Start/End: Complemental strand, 11404312 - 11404222
Alignment:
228 ccttaatttgtcacttttaatgaaaaattcggggttggtgttagttaaaaactagaggaaaaacttgaaagggagaaaagtataatctacc 318  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||  |||||||||||||| ||||||||||||| ||||    
11404312 ccttaatttgtcacttttaatgaaaaattcggggttggtgttagttaaatactagataaaaaacttgaaaggaagaaaagtataatttacc 11404222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University