View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0701_low_1 (Length: 612)

Name: NF0701_low_1
Description: NF0701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0701_low_1
NF0701_low_1
[»] chr1 (1 HSPs)
chr1 (19-200)||(7253412-7253590)


Alignment Details
Target: chr1 (Bit Score: 130; Significance: 5e-67; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 130; E-Value: 5e-67
Query Start/End: Original strand, 19 - 200
Target Start/End: Complemental strand, 7253590 - 7253412
Alignment:
19 cagagaccagaaataggttgcaagtaattgattggtccttcttatcaaattatgacacaactaccacgtttattacatataggtaggtgaccatatgaca 118  Q
    |||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7253590 cagaaaccagaaataggttgcaagtaattgattg-tccttcttatcaaattatgacacaactaccacgtttattacatataggtaggtgaccatatgaca 7253492  T
119 gataaatgaataagacaatatatannnnnnnngaaagagaataactatagacttttactacatgactgaaatttaatttaaa 200  Q
    ||||||||||||||||||| | |         ||||||||||||||||||||||||||||||||||||||||||||||||||    
7253491 gataaatgaataagacaattttt--tttttttgaaagagaataactatagacttttactacatgactgaaatttaatttaaa 7253412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University