View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0701_low_7 (Length: 338)
Name: NF0701_low_7
Description: NF0701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0701_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 4e-97; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 4e-97
Query Start/End: Original strand, 132 - 311
Target Start/End: Complemental strand, 2939917 - 2939738
Alignment:
| Q |
132 |
tattttgtaatgaaacagaaataagaagtcaatttgttgcttatgaagaaaaggatcaacaggagaaagtgaggaactaagcattaggaagaagcaccgc |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2939917 |
tattttgtaatgaaacagaaataagaagtcaatttgttgcttatgaagaaaaggatcaacaggagaaagtgaggaactaagcattaggaagaagcaccgc |
2939818 |
T |
|
| Q |
232 |
atggtgcaaccaagaagttgtgcaacaaaacaaccatcttatcaattggggtattcatttaaggtgttatgctttcatca |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2939817 |
atggtgcaaccaagaagttgtgcaacaaaacaaccatcttatcaattggggtattcatttaaggtgttatgctttcatca |
2939738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 30 - 106
Target Start/End: Complemental strand, 2940225 - 2940149
Alignment:
| Q |
30 |
ttaaatacaaaacatacagaagttccacattatttacaaattaggtttatggatggattgatgaaatcactatggta |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2940225 |
ttaaatacaaaacatacagaagttccacattatttacaaattaggtttatggatggattgatgaaatcactatggta |
2940149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 31 - 134
Target Start/End: Complemental strand, 2939497 - 2939394
Alignment:
| Q |
31 |
taaatacaaaacatacagaagttccacattatttacaaattaggtttatggatggattgatgaaatcactatggtattgtggttctcctaaactcactgc |
130 |
Q |
| |
|
|||||| |||||||||| ||||| || ||||||||| ||||||| |||||| ||||||||||||||| |||||||| || ||||||| ||||||| ||| |
|
|
| T |
2939497 |
taaatagaaaacatacacaagtttcaaattatttactaattaggattatggttggattgatgaaatcgctatggtaccgtcgttctcccaaactcaatgc |
2939398 |
T |
|
| Q |
131 |
ctat |
134 |
Q |
| |
|
|||| |
|
|
| T |
2939397 |
ctat |
2939394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 2930079 - 2930024
Alignment:
| Q |
162 |
aatttgttgcttatgaagaaaaggatcaacaggagaaagtgaggaactaagcatta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||| |||||||||| ||||| |
|
|
| T |
2930079 |
aatttgttgcttatgaagaaaaggatcaacgggaaaaagagaggaactaatcatta |
2930024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 166 - 217
Target Start/End: Complemental strand, 2938301 - 2938250
Alignment:
| Q |
166 |
tgttgcttatgaagaaaaggatcaacaggagaaagtgaggaactaagcatta |
217 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||| |||||||||| ||||| |
|
|
| T |
2938301 |
tgttgcttatgaagaaaaggatcaacgggaaaaagagaggaactaatcatta |
2938250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 312 times since January 2019
Visitors: 4379