View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0702_high_6 (Length: 251)
Name: NF0702_high_6
Description: NF0702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0702_high_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 394976 - 395220
Alignment:
Q |
1 |
ctatgactccagatgaaactatatcagaggttcagaattcagtttctgaggtaccaatacgccacagccttcctataacatcagggattccccgttcttc |
100 |
Q |
|
|
|||||||| ||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
394976 |
ctatgactgcagttgaaactatatcagaggttcagaattcagtttctgaggtaccgatacgccacagccttcctataacatcagggattccccgttcttc |
395075 |
T |
 |
Q |
101 |
gcggcctcccttatatagaaataatcaaggagcttcttcttcttccagatattttttggaacaaagacattatcatcataattatggaacaaagaagatt |
200 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
395076 |
gcggcctcctttatatagaaataatcaaggagcttcttcttcttccagatcttttttagaacaaagacattatcatcataattatggaacaaagaagatt |
395175 |
T |
 |
Q |
201 |
caccatctaaacagctatgtagttaatcaaaagcattcatctcac |
245 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
395176 |
caccatctaaacagctatgtagttaatcaaaagcattcatatcac |
395220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 543 times since January 2019
Visitors: 4385