View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0702_low_11 (Length: 251)
Name: NF0702_low_11
Description: NF0702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0702_low_11 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 30 - 251
Target Start/End: Complemental strand, 24847771 - 24847550
Alignment:
| Q |
30 |
gaaattattggttattttggagctagttgtagcattagatttaatgtaggtaactgtcttgctttctttgtaattggtcttccagataacatcatctttt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24847771 |
gaaattattggttattttggagctagttgtagcattagatttaatgtaggtacttgtcttgctttctttgtaattggtcttccagataacatcatctttt |
24847672 |
T |
|
| Q |
130 |
gcagctccttataattctcttttgggtaagtttcggttgtcatctttctcgtatacaaaccacaaagggatttcttggacatgaagaataacattctttt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24847671 |
gcagctccttataattctcttttgggtacgtttgggttgtcatctttctcgtatacaaaccacaaagggatttcttggacatgaagaataacattctttt |
24847572 |
T |
|
| Q |
230 |
tcttactacaccttataacact |
251 |
Q |
| |
|
||||||||||| |||||||||| |
|
|
| T |
24847571 |
tcttactacactttataacact |
24847550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 321 times since January 2019
Visitors: 4379