View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0702_low_12 (Length: 251)
Name: NF0702_low_12
Description: NF0702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0702_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 32183043 - 32182855
Alignment:
Q |
1 |
ttgaaaactaatgttaaatcataaacaacagattaccacatgtggagtcggcagcaattcatgtaaagctttgaggttatcagcgatacgttgcctgcgt |
100 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
32183043 |
ttgaaaactaatcttaaatcataaacaacagattaccacatgtggagtcggcagcaattcatgtaaagctttgaggttatcagcaatacgttgcctgcgt |
32182944 |
T |
 |
Q |
101 |
tgctatattcaaagagtacagggtaagaaagaaacaaaattgtgttgatgaattggaataagattattaactagttgacaagagcatag |
189 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
32182943 |
tgctatattcaaagagtacacggtaagaaagaaacaaaattgtgttgatgaattggaataagattgttaactagttgacaagagcatag |
32182855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 204 - 239
Target Start/End: Complemental strand, 32182821 - 32182786
Alignment:
Q |
204 |
atatatctgcattttgaatgtggccgttatgatttt |
239 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
32182821 |
atatatctgcattttgaatgtggccgttatgatttt |
32182786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University