View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0702_low_14 (Length: 206)
Name: NF0702_low_14
Description: NF0702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0702_low_14 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 32183252 - 32183047
Alignment:
| Q |
1 |
ctaacaactaactactaatatttgccattcnnnnnnnnngtttaggtctgaaaaggtaccttcacttgaatctgcaagtatttaacatagtcaatgatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32183252 |
ctaacaactaactactaatatttgccattcaaaaaaatagtttaggtctgaaaaggtaccttcacttgaatctgcaagtatttaacatagtcaatgatat |
32183153 |
T |
 |
| Q |
101 |
catccaatatgtaagcttgactaccctgcaaattaaaattcaacgtatatgagctacttaaatttggtcccaaaaaattagctacttaaataacttattc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32183152 |
catccaatatgtaagcttgactaccctgcaaattaaaattcaacatatatgagctacttaaatttggtcccaaaaaattagctacttaaataacttattc |
32183053 |
T |
 |
| Q |
201 |
aataca |
206 |
Q |
| |
|
|||||| |
|
|
| T |
32183052 |
aataca |
32183047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University