View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0702_low_15 (Length: 203)

Name: NF0702_low_15
Description: NF0702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0702_low_15
NF0702_low_15
[»] chr4 (1 HSPs)
chr4 (1-50)||(49697917-49697966)


Alignment Details
Target: chr4 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 49697917 - 49697966
Alignment:
Q  1 tcaatgcataacttctatttatttgaactcttattagttattgtcaattg 50  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  49697917 tcaatgcataacttctatttatttgaactcttattagttattgtcaattg 49697966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University