View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0702_low_5 (Length: 423)
Name: NF0702_low_5
Description: NF0702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0702_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 190 - 394
Target Start/End: Complemental strand, 38609303 - 38609099
Alignment:
Q |
190 |
ctatgatatctctctatcgtctctttgtaaagcttgtttgcattgtgtttattgcaaatataagttaatttcttcaaaatttgtatttaaacaacatgtt |
289 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38609303 |
ctatgatatctctctatcgtctctttgtaaagcttgtttgcattgtgtttattgcaaatataagttaatttcttcaaaatttgtatttaaacaacatgtt |
38609204 |
T |
 |
Q |
290 |
tcgaaggaataaaatgatgttaggttattgtgtcgtcagtttatcaagttatatgaggcacattgctctttgtttgtgtgtcatatattattcgtaggtt |
389 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
38609203 |
ccgaaggaataaaatgatgttaggttattgtgtcgtcagtttatcaagttatatgagtcacattgctctttgtttgtgtgtcatatattatttgtaggtt |
38609104 |
T |
 |
Q |
390 |
caggt |
394 |
Q |
|
|
||||| |
|
|
T |
38609103 |
caggt |
38609099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 182; E-Value: 3e-98
Query Start/End: Original strand, 13 - 255
Target Start/End: Complemental strand, 38609548 - 38609304
Alignment:
Q |
13 |
aatatcgtatgtaacttgtttgtcatattaccttttttacatttatgaatgcactaatcatgtctcacagggcccaaaaatacatgcggagatccacaaa |
112 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38609548 |
aatatcgtatgtaacttgtttgtcactataccttttttacatttatgaatgcactaatcatgtctcacagggcccaaaaatacatgcggagatccacaaa |
38609449 |
T |
 |
Q |
113 |
aatgggcatgggcttggtcaggtgagtcgtggaggatcctctgctacttcaa-nnnnnnnnnattattgt-aaccgtgcctatgatatctctctatcgtc |
210 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||| ||||||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
T |
38609448 |
aatgggcatgggcttggtcaggtgagtcatggaggatcatctgctacttcaattttttttttattattgtcaaccgtgcctatgatatctctctatcgtc |
38609349 |
T |
 |
Q |
211 |
tctttgtaaagcttgtttgcattgtgtttattgcaaatataagtt |
255 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38609348 |
tctttgtaaagcttgtttgcattgtgtttattgcaaatataagtt |
38609304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 187 - 341
Target Start/End: Complemental strand, 38604270 - 38604116
Alignment:
Q |
187 |
tgcctatgatatctctctatcgtctctttgtaaagcttgtttgcattgtgtttattgcaaatataagttaatttcttcaaaatttgtatttaaacaacat |
286 |
Q |
|
|
|||||||||| |||||||||| ||||| ||| || |||||||||||| |||| |||||| |||||| ||||||||||||||| | ||| ||| ||||||| |
|
|
T |
38604270 |
tgcctatgatgtctctctatcctctctctgtgaaacttgtttgcattttgttaattgcagatataatttaatttcttcaaaactagtaattagacaacat |
38604171 |
T |
 |
Q |
287 |
gtttcgaaggaataaaatgatgttaggttattgtgtcgtcagtttatcaagttat |
341 |
Q |
|
|
|||| ||| |||||||||| |||||| ||||| | |||| ||||||| ||||| |
|
|
T |
38604170 |
gttttagagggataaaatgatcttaggtcattgtattgtcaatttatcatgttat |
38604116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University