View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0705_low_12 (Length: 251)
Name: NF0705_low_12
Description: NF0705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0705_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 8829368 - 8829606
Alignment:
Q |
1 |
gtaaaacatgatttgcctccccctccactgtcttgagaaagtgttgcttgtattgtgaacaacatgatgaattgaattggaaaacttattatgacttcct |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
8829368 |
gtaaaacatgatttgcctccccctccactgtcttgagaaagtgttgcttgtattgtgaacaacatgatgaattgaattggaaaact------gacttcct |
8829461 |
T |
 |
Q |
101 |
ctcatactatttatagtttatattaaactaattgctgcatggttaaaagactccacagatgccattatgttgataccagactctcatggtaaacatgtag |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8829462 |
ctcatactatttatagtttatattaaactaattgctgcatggttaaaagactccacagatgccattatgttgataccagactctcatggtaaacatgtag |
8829561 |
T |
 |
Q |
201 |
atccaagttccaactcaagtttgcctaaaatcctagaataatcta |
245 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
8829562 |
atccaagttccaactcaagtttgcctaaaatcctaggataatcta |
8829606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 512 times since January 2019
Visitors: 4385