View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0705_low_13 (Length: 250)
Name: NF0705_low_13
Description: NF0705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0705_low_13 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 12 - 250
Target Start/End: Complemental strand, 40843616 - 40843378
Alignment:
| Q |
12 |
aatactggtactacttgctagtatagcttgtagtattagaggatggtgttaaatcgannnnnnnnnnnnggtgaataaatcgattttaatactacaaaaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40843616 |
aatactggtactacttgctagtatagcttgtagtattagaggatggtgttaaatcgatttttattttttggtgaataaatcgattttaatactacaaaaa |
40843517 |
T |
|
| Q |
112 |
atttccccttcnnnnnnntactcctacaaaaattctgtgttcaaatatcaaaacagtatgcggttttgttggatttgtannnnnnnnacaattgatctga |
211 |
Q |
| |
|
||||||||||| || | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| || |
|
|
| T |
40843516 |
atttccccttcaaaaaaataatactacaaaaattctgtgttcaaatatcaaaacagtatgcggttttgttggatttgtattttttttacaattgatccga |
40843417 |
T |
|
| Q |
212 |
ttaaatgtggtctaggatggaattggaattgatagaatg |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40843416 |
ttaaatgtggtctaggatggaattggaattgatagaatg |
40843378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 827 times since January 2019
Visitors: 4393