View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0705_low_6 (Length: 287)
Name: NF0705_low_6
Description: NF0705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0705_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 49 - 233
Target Start/End: Complemental strand, 17997486 - 17997302
Alignment:
| Q |
49 |
gagcagagacaggggtacttacttacaaattacccactaacaaagtcttaatgttggcagagggagttgaacttatgctcttgtggggtacgaaccaact |
148 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17997486 |
gagcacagacaggggtacttacttacaaattacccactaacaaagtcttaatgttggcagagggagttgaacttatgctcttgtgtggtacgaaccaact |
17997387 |
T |
|
| Q |
149 |
gctaaccgcttgtgataggaaatgatggttttcttttgttgttatacctttttgaataaacttgaaaaaatgtgtacatgcacag |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17997386 |
gctaaccgcttgtgataggaaatgatggttttcttttgttgttatacctttttgaataaacttgaaaaaatgtgtacatgcacag |
17997302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 305 times since January 2019
Visitors: 4379