View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0705_low_7 (Length: 278)
Name: NF0705_low_7
Description: NF0705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0705_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 49 - 243
Target Start/End: Complemental strand, 33064000 - 33063808
Alignment:
Q |
49 |
catcatcatgcatcagaaagactgagagtatatagtatggtcaaatattagcannnnnnnnnnataaaaagaaggccattgtcaatgattataagagtta |
148 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| | |
|
|
T |
33064000 |
catcatcatgcatcagaaagactgagagtatatagtattgtcaaatattagcattttttta--ataaaaagaaggccattgtcaatgattataagagtca |
33063903 |
T |
 |
Q |
149 |
gtccgtcccgagctaaaactcatttggtgtcacagtgaaattgccggtgagtcaccaaacttgtactacatccttgaatttcacaggttctgctc |
243 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
33063902 |
gtccgtcccgagctaaaactcatttggtgtcacagtgaaattgccggtgagtcaccaaacttgtactacatccttgaatttcacaggttttgctc |
33063808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University