View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0705_low_9 (Length: 255)
Name: NF0705_low_9
Description: NF0705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0705_low_9 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 28 - 255
Target Start/End: Original strand, 8829119 - 8829346
Alignment:
Q |
28 |
cagagaagagtgaaggagaaacaaagttcctcttatgaactccttaatacatcaacaacaacatcattggagtctttactgcatggaatggacaattcaa |
127 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8829119 |
cagagaagagtgaaggagaaacaaagttcctcttatgaactccttaatacatcaacaacaacatcattggagtctttactgcatggaatggacaattcaa |
8829218 |
T |
 |
Q |
128 |
atcactctgacttaatcagtgagattgaggaaggaagttcctcaggaataaaagatatttgtcattctaactttgatgatgtgtcaatgattcaaagcaa |
227 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8829219 |
atcactctgacttaatcagtgagattgaggaaggaagttcctcaggaataaaagatatttgtcattctaactttgatgatgtgtcaatgattcaaagcaa |
8829318 |
T |
 |
Q |
228 |
tgcaaaaattccaagttatgatgaagat |
255 |
Q |
|
|
|||||||||||||||||||||||||||| |
|
|
T |
8829319 |
tgcaaaaattccaagttatgatgaagat |
8829346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 182 times since January 2019
Visitors: 4371