View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0706_low_10 (Length: 251)
Name: NF0706_low_10
Description: NF0706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0706_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 31480804 - 31480565
Alignment:
| Q |
1 |
ttgttgctatttttgtaagcattgcatttaggccttgacttttatcccacaaaattcattcaaatttactttaaaatatccctacggtccttgatgaaat |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31480804 |
ttgttgctgtttttgtaagcattgcatttaggccttgactttcatcccacaaaactcattcaaatttactttaaaatatccctacggtccttgataaaat |
31480705 |
T |
 |
| Q |
101 |
tttcctatttggtcgggacttttatcatcgagtgattggtttggtttcacaatacaaaccaatataattggttcatttttcccatattaggatccaaacc |
200 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31480704 |
tttccaatttggtcgggacttttatcatcgagtgattggtttggtttgacaatacaaaccaatataattggttcatttttcccatattaggatccaaact |
31480605 |
T |
 |
| Q |
201 |
aatcaaatccaacctctattggtccgagcatcagtttcat |
240 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31480604 |
aatcaaatccgacctctattggtccgagcatcagtttcat |
31480565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University