View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0706_low_7 (Length: 292)
Name: NF0706_low_7
Description: NF0706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0706_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 71 - 239
Target Start/End: Complemental strand, 7168687 - 7168519
Alignment:
Q |
71 |
aaatatttggtgaagattgaatacaggcttttggtagaattgacaatgtttctgttgaaacatttcccacttcaagattgttgtgcttgtcctgaattgc |
170 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7168687 |
aaatatttggtgaagattgaatacaggcttttggtagaattgacaatgtttctgttgaaacatttcccacttcaagattgttgtgcttgtcctgaattgc |
7168588 |
T |
 |
Q |
171 |
ttgtgaacaagaagaagacccatgaaaagtatttgtcttcattagttttgaagattttatttcagccta |
239 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7168587 |
ttgtgaacaagaagaagacccatgaaaagtatttgtcttcattagttttgaagattttatttcagccta |
7168519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University