View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707-INSERTION-10 (Length: 166)
Name: NF0707-INSERTION-10
Description: NF0707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0707-INSERTION-10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 1e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 1e-51
Query Start/End: Original strand, 8 - 165
Target Start/End: Complemental strand, 13484168 - 13484011
Alignment:
Q |
8 |
atatcgatattaatcggtgccaaaatagcacgtatgaatcaagggctcattctccaacactataaagctagtataaattaaatttgcannnnnnnnnnnn |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
13484168 |
atatcgatattaatcggtgccaaaatagcacgtatgaatcaagggctcattctccaacactataaaactagtataaattaaatttgcatttttctttttc |
13484069 |
T |
 |
Q |
108 |
nnnnngcttcaaaaaacgaaccctaagctttatatttatagatgccatacatatactg |
165 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13484068 |
tttttgcttcaaaaaacgaaccctaagctttatatttatagatgccatacatatactg |
13484011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University