View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707-INSERTION-15 (Length: 67)
Name: NF0707-INSERTION-15
Description: NF0707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0707-INSERTION-15 |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 60; Significance: 2e-26; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 60; E-Value: 2e-26
Query Start/End: Original strand, 8 - 67
Target Start/End: Complemental strand, 32904483 - 32904424
Alignment:
Q |
8 |
ccaaccaggggtaagggtttgaatggattgatgagtagtttgaaaaaggttacttgctga |
67 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32904483 |
ccaaccaggggtaagggtttgaatggattgatgagtagtttgaaaaaggttacttgctga |
32904424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1237 times since January 2019
Visitors: 4365