View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707_1D_high_12 (Length: 237)
Name: NF0707_1D_high_12
Description: NF0707_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0707_1D_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 7 - 103
Target Start/End: Complemental strand, 39545823 - 39545727
Alignment:
Q |
7 |
tgtatctgacggtataaaatacttgctcataataagagattagtgacactctctcaccggagacaccgtcttagaatattgaaactatatgcatatc |
103 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
39545823 |
tgtatccgacggtataaaatacttgctcataataagagattagtgacactctctcaccggagacagcgtcttagaatattgaaactatatgcatatc |
39545727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 145 - 234
Target Start/End: Complemental strand, 39545685 - 39545596
Alignment:
Q |
145 |
tgagcactaaagagaataacgaacttcaacaaatgacgaatcgtttaagataacataagtgtatttatctgttggccgaacaccaaactc |
234 |
Q |
|
|
||||| ||||||||||| |||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |||||||| ||| |||| |
|
|
T |
39545685 |
tgagccctaaagagaatgacgaacttcaacaaatgatgaatcgtttaagataacataagtttatttatctgtcggccgaactccagactc |
39545596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University