View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707_1D_high_13 (Length: 234)
Name: NF0707_1D_high_13
Description: NF0707_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0707_1D_high_13 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 7 - 232
Target Start/End: Original strand, 9526286 - 9526511
Alignment:
Q |
7 |
ctgagatgaataaaccttggtcttctgcaaactcaactgcatcttcagtaggaaccattctcaagtcaacaaggtcacctttgttaccaactagcatgat |
106 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
9526286 |
ctgagaagaataaaccttggtcttctgcaaactcaactgcatcttcagtagggaccattctcaaatcaacaaggtcacctttgttaccaactagcatgat |
9526385 |
T |
 |
Q |
107 |
cacaattgagttatctgcatgtgctctaagttcctcaacccatttagcaacatgatcaaatgattgtcttttggttatgtcatatactagcatggctcct |
206 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| |||||| |
|
|
T |
9526386 |
cacaattgagttatctgcatgtgctctaagttcctcaacccatttagcaacatgatcaaaagattgccttttggttatgtcatatactagcattgctcct |
9526485 |
T |
 |
Q |
207 |
aatgcacctctatagtatgcacttgt |
232 |
Q |
|
|
|||||||||||||||||||||||||| |
|
|
T |
9526486 |
aatgcacctctatagtatgcacttgt |
9526511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 75 - 234
Target Start/End: Complemental strand, 48932348 - 48932189
Alignment:
Q |
75 |
acaaggtcacctttgttaccaactagcatgatcacaattgagttatctgcatgtgctctaagttcctcaacccatttagcaacatgatcaaatgattgtc |
174 |
Q |
|
|
||||| |||||||||||||||| |||||||||||| || ||||| || || |||| | |||||||||| |||| |||| ||||||||||| | ||||| |
|
|
T |
48932348 |
acaagatcacctttgttaccaattagcatgatcacgatggagttgtcggcgtgtgaccgtagttcctcaatccatctagctacatgatcaaacgtttgtc |
48932249 |
T |
 |
Q |
175 |
ttttggttatgtcatatactagcatggctcctaatgcacctctatagtatgcacttgtaa |
234 |
Q |
|
|
|||| ||||||||||| || |||||||| |||||||| ||||| |||||||||||||||| |
|
|
T |
48932248 |
ttttagttatgtcatacaccagcatggcccctaatgctcctctgtagtatgcacttgtaa |
48932189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1838 times since January 2019
Visitors: 4432