View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707_1D_high_16 (Length: 213)
Name: NF0707_1D_high_16
Description: NF0707_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0707_1D_high_16 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 59 - 213
Target Start/End: Original strand, 45483080 - 45483234
Alignment:
| Q |
59 |
atatctgatacattacacgctactcttcttggatttggatgtgatcacgcagtcaacatgttagtagtgttggatcgagatcggacaattcatatttcaa |
158 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45483080 |
atatctgatacattatacgctactcttcttggatttgaatgtgatcacgcagtcagcatgttagtagtgttggatcgagatcggacaattcatatttcaa |
45483179 |
T |
 |
| Q |
159 |
tttcgacatttctattttcttaaaatcaaaatctgtattaaaatctaaaccacct |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45483180 |
tttcgacatttctattttcttaaaatcaaaatctgtattaaaatctaaaccacct |
45483234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 10 - 58
Target Start/End: Original strand, 45483007 - 45483059
Alignment:
| Q |
10 |
attatacttttgtcaaacctatctaac----agctggaatagcaattgtgtta |
58 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
45483007 |
attatacttttgtcaaacctatctaacagctagctggaatagcaactgtgtta |
45483059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University