View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707_1D_high_3 (Length: 399)
Name: NF0707_1D_high_3
Description: NF0707_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0707_1D_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 6e-87; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 6e-87
Query Start/End: Original strand, 28 - 202
Target Start/End: Original strand, 9574961 - 9575135
Alignment:
Q |
28 |
aagggatttcacttgtaccaacaaacttctaaaatagccacataaatgttatttggacaacaattttgttgtccgacacggtaagcatactagaactgct |
127 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
T |
9574961 |
aagggatttcacttgtaccaacaaacttctaaaatagccacataaatgttatttggacaacaattttgttgtccgacaccgtaagcatgctagaactgct |
9575060 |
T |
 |
Q |
128 |
taagaattcttgctttagtagtgtgcagtaaattttgagtatgtctggaaatagtggcagtttcaccgagcttac |
202 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
9575061 |
taagaattcttgctttagtagtgtgcagtaaattttgagtatgtctggaaatagtgtcagtttcaccgagcttac |
9575135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 306 - 392
Target Start/End: Original strand, 9575239 - 9575325
Alignment:
Q |
306 |
cttaactgtttattccttcaatcggtaaaaggctttcctcaaaataaaccattatcggacaacaacatctatcacctttaacaccaa |
392 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
9575239 |
cttaactgtttattccttcaatcggtaaaacgctttcctcaaaataaaccattatcggacaataacatctatcacctttaacaccaa |
9575325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University